From Your DNA to You

In this post I am just going to explain the beginning of the process for how our DNA shapes our bodies.  An incredibly complex series of chemical reactions embody the heart of the mechanism that creates a living organism from what amounts to a series of data, encoded as chemicals known as deoxyribonucleic acid.  The entirety of this process is still somewhat unknown as there are a lot of factors, outside of DNA itself, that contribute to how a complex organism such as humans develop.
In molecular biology, the process by which proteins are produced from DNA is called the "Central Dogma", coined by Francis Crick in 1958 (one discoverer of the structure of DNA).  I will stick to the basics of this process.  The entire point of DNA is to be a set of instructions for assembling proteins.  Let us define exactly what a protein is (from Wikipedia):
"Proteins (also known as polypeptides) are organic compounds made of amino acids arranged in a linear chain and folded into a globular form."

Proteins allow cells to burn energy, hold their shape and perform their specified function.  In fact about half of a cell's weight is made up of proteins.  Amino acids are the building blocks that make up proteins, and the order in which these amino acids are placed, accounts for the shape (and therefore function) that proteins take.  A protein's shape is crucial to their function.  In fact, a protein that has the same amino acid (and chemical) composition as another, but is folded (the term for protein shaping) even slightly differently, can have a completely different function.

So we have the general flow of how DNA works:

DNA's specific order is converted to a series of amino acids that are linked and then folded into a protein.

This specific series of DNA that encodes for a specific protein is called a gene.

At each of these levels the complexity of the end result grows.  There are only four different pieces of DNA that encode for data:

A (adenine), C (cytosine), G (guanine) and T (thymine). These are called nucleotides (or base-pairs).  These four different nucleotides code for only twenty-two different amino acids (in multi-celled organism, there are as many as forty used by single celled organisms).  From twenty-two amino acids, there are limitless protein combinations and shapes.

A typical string of DNA twenty-one base-pairs long would be:
ATGACGGAGCTTCGGAGCTAG

This string of DNA is "transcribed" to a string of RNA (ribonucleic acid).  RNA is nearly identical to DNA except thymine (T) is exchanged for uracil (U).  This string is then passed to a cell's organelle called a Ribosome, which reads this strand three base-pairs at a time.  These sequences of three nucleotides are called codons.  In my example of the twenty-one nucleotides, there are seven codons.  The ribosome starts protein synthesis (or translation) at only one specific codon, which is AUG (or ATG for the DNA version).  This also codes for the amino acid Methionine. The second codon ACG codes for Threonine, the third GAG for Glutamic Acid, the fourth CTT (or CUU in RNA) for Leucine, the fifth CGG for Arginine, the sixth AGC for Serine and the last codon TAG (or UAG in RNA) is a stop codon, which tells the ribosome to stop translation of the protein.  You can see a full table for which codons correspond to which amino acids here.  So for our example, we have a protein that is six amino acids long.  After the amino acids are linked together, other proteins come in and fold the amino acid chain into the proper shape.

If you are interested in reading more here is the Central Dogma page on Wikipedia.  Follow the table on the right for a more in-depth explanation of the entire process.