Robert Reich on Real Time

I feel like I have tapped into the political zeitgeist in some way with my two Robert Reich posts (you can find his blog here).  Bill Maher had Robert on his show last Friday (9-17-10) and he is excellent on it.  Here are a couple quotes from the HBO site:

Last year, just to give you one example, the top 25 hedge fund managers in this country earned, on average, a billion dollars.  A billion dollars each... That would pay for 20,000 teachers.  You see how out of whack everything has become?

I think the Democrats are very afraid of being classified as class warriors...because they thing that everybody in America wants to and expects to be rich, and therefore everybody in America believes that one day they're going to be at the top, and therefore, they don't want to be taxed.

I couldn't get to any clips from his show except the Overtime clip, which you can watch here, and Robert does a great job.  Bill Maher is up there with Jon Stewart as far as one of the best in the media for running their show with a largely fair group of guests and questions.  I love the dialog that happens on Real Time.  One of my favorite quotations to describe the government's place happened on Bill's show, said by long time PBS newsman Bill Moyers, paraphrased:

Laws are there to make bad people do good things.

Here is the video:

Civ V Follow Up

I woke up early to fire up Civ V this morning at 8am MDT, and played nearly non-stop until 7PM.  The new unit control, including one-unit per tile, hexagonal tiles and ranged combat all added a lot to the complexity of the combat.  All forms of artillery, including ships and archers are now able to completely kill a unit, which seemed like a no-brainer.  I started a game on the largest map and slowest time so I haven't gotten to air combat yet, however if the changes to other ranged units and boats are consistent, it may be the best air combat style too.  Cities having their own inherent defenses, including HP and bombardment, is a great addition too.  From what I have seen so far, Civ V is the best of the franchise, building on the giants that came before it.

Civilization V

The Civilization series of video games gets its fifth installment on Tuesday.  This is a highly anticipated release, so I am paying homage to it with a brief summary of the first four, to atone for all of the time I wasted on them.
Civilization (or Civ I) came out in 1991, and as such I don't remember actually playing too much of this one.  The game introduced the basic model, which carries through to Civilization V.  Build cities, research technology, build units and wage war.  The unit combat is the simplest with each unit just having an attack value and defense value.  The attack value of one unit is compared to the defense value of another, which produces a proportion.  This is the chance the attacking unit will beat the defending.  A random roll is done and one unit is destroyed, and the other survives, fully intact.

This results in the notorious "phalanx defeats tank" phenomenon in which ancient units can seem absurdly over-effective. The effect is worsened by stacking multiplicative modifiers, so that when a modern tank(attack 8) attacks a phalanx of spearmen (defense 2) that's a veteran (+50%) fortified (+50%) on a mountain (+200%), the two are evenly matched.

In 1996 Civilization II was released.  There were a few big things that it changed.  Firstly, the map shifted to an isometric perspective, which became the standard for Civilization games.  Secondly, units started with hit points (HP) and combat happened in rounds.  Each round, the game randomly rolls, based on the proportion of attack to defense.  This is repeatedly done until one of the units HP reaches zero.  They made this change to eliminate the "phalanx defeats tank" problem of the first game, which it only partially addresses.  I like this change because you have to "heal" up a victorious unit after a tough battle.  Civ II added one last thing to the game-play of Civ I, a victory condition outside of just destroying all other civilizations and a scoring system.  When one reached the later stages of the game, one would have the opportunity to construct a space-ship to Alpha Centauri.  If one finishes building and launching the ship, it travels and reaches its destination, the game ends.  The game also ends at 2020 regardless and scores are compared to determine the winner.  The game scores each civilization base on the number of World Wonders they have built, happy population and years of peace (with bonus points if the game ended by reaching Alpha Centauri).

In 1999, Sid Meier released a non-"Civilization" game named Alpha Centauri (Sid Meier's Alpha Centauri or SMAC).  SMAC was the spiritual successor to Civ II, as it was developed by the same team that produced Civ II.  The game-play was nearly identical, however it introduced a unique feature: fully customizable units.  SMAC also introduced unique Civilization bonuses, similar to those used later in Civilization 3, and government system bonuses similar to those in Civilization 4.  Civ V also uses a special World Wonder as a win condition, like SMAC's Ascent to Transcendence.

Civilization III hit the market in 2001.  In some ways Civ III was a step backward from SMAC.  It did not have SMAC's elevation changes in the map, "group movement" for units (though it was added by a patch later) and robust government options.  Despite this, Civ III introduced one of best new mechanics to the series: culture.  This allowed your civilization to have a border and reveal the territory within it.  Also, it carried over the concept of specialized units for improving terrain, from SMAC, in the form of workers.  In Civ II, settlers filled that role.  Civ III also expanded the victory conditions to Conquest, Domination, Cultural, Space Race and Diplomatic.  From Wikipedia:

A Conquest victory is achieved when no civilizations besides the player's exist, a civilization being eliminated when its last city is captured or destroyed.

A player wins a Domination victory by controlling two thirds of the world's land and population. 66% of the world's land area must be within the civilization's cultural borders, and 66% of the world's population must reside within the civilization's cities.

The Cultural victory is achieved when either one city the player controls has 20,000 or more culture points, or if the entire civilization meets a certain threshold (100,000 on a Standard map) and has at least double that of any other culture.

The Space Race is nearly identical to the Alpha Centauri victory condition from Civ II.  The last win condition, Diplomatic, is achieved by building the U.N. World Wonder, getting elected "Secretary General" and winning the victory option election by a simple majority.  The time limit game option also remains, the winner of which is determined by score in a similar fashion to Civ II.

The latest game in the series, Civilization IV, refines many parts of the Civilization formula.  The victory conditions are nearly identical to Civ III, as well as the map being fairly similar.  The game had a controversial addition to the game, religion, as well as "Great People".  These special units came in the form of either artists, merchants, prophets, engineers or scientists, and each had a slightly different one-time ability.  Civ IV also refined the government options to easily the best system so far of flexible civics.  The unit and combat system was also the best so far.  From Wikipedia:

Military units no longer have separate ratings for attack, defense and health, but instead a single strength rating. The combatants' strengths are modified by multiplicative promotion and circumstance bonuses, and the highest number generally wins. As of the game's most recent patch, a damaged unit loses half that amount of combat strength. The player may now check the probability of success before commissioning an attack. The revised combat system was largely in response to the "spearman-defeats-tank" problem that has plagued Civilization since its first iteration, wherein weak and obsolete units (generally controlled by the AI) would defeat stronger and more modernized forces (generally controlled by the player) on a far more regular basis than common sense would suggest possible.

One of my complaints with the combat system (which has persisted across the entire series), is the relative ineffectiveness of air units.  They always seem to be tacked on as an afterthought and made to be glorified artillery.  Also, the elevation system used in SMAC made a lot of sense.  I feel it added to the immersiveness of the map layout, as well as allowing worker units (called terraformers in SMAC) to change the elevation of tiles to manipulate water (for example).

Lastly, I leave you with a quotation from Jerry Holkins at Penny Arcade:

Via some methodology I am not entirely certain of, I received a working code for a review copy of Civilization V. I have played it enough to know that it is a game of clean lines and flawless ratios unbounded by the smooth corners of the world it simulates. It's perfect and deathless and it isn't going anywhere, ready the very moment I summon it to enclose me in its pure structures. It's the maximized centerfold archetype when what I'm after is filthy, anonymous, alleyway rutting. That's King's Bounty.

Polyphasic Sleep

Polyphasic sleep is a term for going to sleep many times a day, rather than monophasic or biphasic, the two most common sleep schedules.  The idea behind polyphasic sleep is that one takes many small naps throughout the day, in effort to get more total waking hours in a 24-hour period.  The most extreme of these schedules is known as the "Uberman" sleep schedule, in which one takes a 20 minute nap, every 4 hours, which makes 2 hours of sleep per 24-hours (22 waking hours).  This schedule has problems, the largest being it is incredibly difficult to adjust to.  The first few weeks, one is in a state of sleep deprivation.  It takes incredible determination and discipline.  The naps need to be taken at exactly the same time (to the minute) each day for the schedule to work.  From the Uberman schedule, the "Everyman" schedule was developed, which is a "core nap" of 3 hours and 3 20 minute naps spaced throughout the day.  This schedule is a lot easier to adjust to and requires less discipline with the "micro naps".
Here is a chart from the Wikipedia page, visually comparing the different schedules:

Interestingly, Dymaxion sleep is the schedule used by Buckminster Fuller before the phenomenon of polyphasic sleep was ever described.  In fact, many figures through-out history utilized a similar sleep schedule, including: Leonardo da Vinci, Benjamin Franklin, Thomas Jefferson, Thomas Edison, Nikola Tesla and Winston Churchill.

Here are a couple more sites for information regarding polyphasic sleep:
Polyphasic Sleep: Facts and Myths

Polyphasicsleep.info

Body Mass Index

Body Mass Index (or BMI) is a quick way of converting one's height and weight into one metric.  The problem is that the BMI metric is largely without value.  It is not any better of a metric of health than someone's height or weight alone.  According to the Mayo Clinic:

FINDINGS: We found 40 studies with 250,152 patients that had a mean follow-up of 3.8 years. Patients with a low body-mass index (BMI) (ie, <20) had an increased relative risk (RR) for total mortality (RR=1.37 [95% CI 1.32-1.43), and cardiovascular mortality (1.45 [1.16-1.81]), overweight (BMI 25-29.9) had the lowest risk for total mortality (0.87 [0.81-0.94]) and cardiovascular mortality (0.88 [0.75-1.02]) compared with those for people with a normal BMI. Obese patients (BMI 30-35) had no increased risk for total mortality (0.93 [0.85-1.03]) or cardiovascular mortality (0.97 [0.82-1.15]). Patients with severe obesity (> or =35) did not have increased total mortality (1.10 [0.87-1.41]) but they had the highest risk for cardiovascular mortality (1.88 [1.05-3.34]).

Their data shows that BMI is not a reliable metric for predicting health outcomes.  From a medical or scientific standpoint the metric BMI is just not valuable.  Another study published in the American Journal of Public Health found:

Traditional BMI categories do not conform well to the complexities of the BMI–mortality relationship. In concurrence with conclusions from previous literature, I found that the current definitions of obesity and overweight are imprecise predictors of mortality risk.

If a gut level reaction to assessing health by height and weight alone is not enough, take a look at the Wikipedia section on it.

Some argue that the error in the BMI is significant and so pervasive that it is not generally useful in evaluation of health.  University of Chicagopolitical science professor Eric Oliver says BMI is a convenient but inaccurate measure of weight, forced onto the populace, and should be revised.

The medical establishment has generally acknowledged some shortcomings of BMI. Because the BMI is dependent only upon weight and height, it makes simplistic assumptions about distribution of muscle and bone mass, and thus may overestimate adiposity on those with more lean body mass (e.g. athletes) while underestimating adiposity on those with less lean body mass (e.g. the elderly).

The problem with making the connection between BMI and overall healthfulness is that the metric is then used inappropriately, for example by health insurance companies.

In the United States, where medical underwriting of private health insurance plans is widespread, most private health insurance providers will use a particular high BMI as a cut-off point in order to raise insurance rates for or deny insurance to higher-risk patients, thereby ostensibly reducing the cost of insurance coverage to all other subscribers in a 'normal' BMI range. The cutoff point is determined differently for every health insurance provider and different providers will have vastly different ranges of acceptability.

Another article published in The Dartmouth, Dartmouth College's student newspaper, proposes that insurance and pharmaceutical companies actually have a financial incentive for embracing and perpetuating the use of the flawed BMI metric.

According to Oliver, the "obesity mafia" consists of government health agencies such as the National Institute of Health, the Center for Disease Control and the Food and Drug Administration. These agencies are linked in symbiotic relationships with drug companies and academic researchers, with the trio feeding off one another to perpetuate the myth of widespread obesity in America -- all for financial gain.

Because Moderates Shouldn't Be Drown Out

One of the funny things about political activism, whether on the left or right, is that those with moderate (centrist) viewpoints are often missed.  Talking heads that yell the loudest and espouse the craziest ideas are those that get the most TV time.  For this reason, the only news TV show I watch regularly is The Daily Show.  Last night Jon Stewart and Steven Colbert announced an event at Washington D.C.

We're looking for the people who think shouting is annoying, counterproductive, and terrible for your throat; who feel that the loudest voices shouldn't be the only ones that get heard; and who believe that the only time it's appropriate to draw a Hitler mustache on someone is when that person is actually Hitler. Or Charlie Chaplin in certain roles.

Also Stewart had President Clinton on, who had an excellent interview.
Part 1 and Part 2
Why can't we have democrats that are actually in office do this much?

Best "Always Sunny" Episodes

In celebration of the new season of It's Alway Sunny in Philadelphia, premiering tonight, I have compiled the top episodes.  I am assuming that the reader has watched each of these episodes and just doing a short-hand of the best parts for each of the best episodes.  At the end I will name the top 5 episodes.

Back to Robert Reich

Here is a transcript of one of the most important parts of the video I posted a couple days ago.  I touched briefly on this, however I wanted to post it, because I feel it is very important to consider Reich's words.  Note this speech was made in 2005, before the Tea Party movement.

Starting at 53:18, I transcribed this myself, so corrections are welcome.

The working class, that we used to call it, and the poor, increasingly become vulnerable to demagogues, who come along and take their frustration and their anxiety and turn it into and divert it toward targets of animosity.  We’ve seen this before in history.  I don’t have to tell you.  We’ve seen it a little in the United States, not much, but we have seen angry populism.  We saw it in the 1890’s.  The predecessor of progressivism was populism.  William Jennings Bryant, prairie populism, it was an angry populism.  It was an angry divisive populism.  It was an angry divisive populism that blamed a lot of people, some of them who were scapegoats for that populism.  Anti-modernist movements around the world and historically have been animated by demagogues preying upon the anxieties of people who need targets of resentment.  The politics of resentment is not new, folks and when you hear people accusing people like me of being class warriors what I want you to understand is the failure to act on these trends invites real class warfare.  Indeed you might say what we have begun to see, and we began to see it in the 2004 election, was a kind of angry cultural populism that is the first cousin of angry class populism, cultural populism that blames, blames who? Blames eastern elites and western elites, blames Hollywood, blames university towns like Berkeley, blames Jews, blames the French, blames immigrants, blames others.  The politics of resentments that is carried upon and depends upon anxiety and frustration and is utilized by demagogues to further their own selfish purposes.  That’s what snapping apart, snapping-breaking could invite.

A modern society in the 21st century has universal healthcare, has unemployment benefits, has inexpensive education, women have personal rights in regards to their bodies, people can love whoever they choose, is secular, does not support state-sponsored murder, and is welcoming to immigrants of different races, cultures and religions.  America is heading toward (maybe irreversibly) that "snap" that Reich talks about and the Tea Party is absolutely an agent of change for the worse, which is helping to push us towards it.

Thought Experiment

I conceived of this theoretical physics thought experiment many years ago, and it may not be completely original, however I have not read of any other that is similar. It proves the ability to transfer information faster than light within the model of traditional Newtonian physics.

Imagine a device sitting in space. The central part of this device is a metal rod one light year (9.461×10¹² kilometers) long.  At both ends of this rod are detectors not much more complex than Morse code receivers.  This rod could then be set to move back and forth in such a way that information is passed from one end to the other nearly instantly, which would take a radio wave a year to pass from one end to the other.

Now take this example to the next logical conclusion.  What if the rod was only 0.1 light year long?  How about a few hundred kilometers long?  In theoretical physics, the transfer of information is just as good as actually moving an object.  Imagine that at one end of this device there is a detector that downloads all of the information about an object (in a theoretical sense, this means all of the atoms and particles that make up this object are known).  This data can be then transmitted by the device and reconstructed on the other end.
Now there are many practical problems with this device, however this is just a thought experiment.  If you want to read more about thought experiments here is the Wikipedia page.

Income Inequality in the United States

Timothy Noah at Slate Magazine recently started a series on the growing income disparity between the richest percentage and the poorest percentage.  His first post goes into exactly how great this gap has become and why many Americans are ignorant of the problem. By the numbers "the richest 1 percent account for 24 percent of the nation's income" as well as "from 1980 to 2005, more than 80 percent of total increase in Americans' income went to the top 1 percent".  This is despite a productivity increase (among all workers) of "about 20 percent" in the last decade alone.

Here is a great online lecture by former Secretary of Labor Robert Reich, recorded in April 2005, titled "How Unequal Can America Get Before We Snap?".

At the end of the lecture he unwittingly predicts the Tea Party movement, which is almost prophetic.  This next video is a lecture given by Harvard Law professor, Elizabeth Warren, about the loss of the middle class in America over the past generation.  The first 5:30 is introduction that can be skipped without missing anything important.

From Your DNA to You

In this post I am just going to explain the beginning of the process for how our DNA shapes our bodies.  An incredibly complex series of chemical reactions embody the heart of the mechanism that creates a living organism from what amounts to a series of data, encoded as chemicals known as deoxyribonucleic acid.  The entirety of this process is still somewhat unknown as there are a lot of factors, outside of DNA itself, that contribute to how a complex organism such as humans develop.
In molecular biology, the process by which proteins are produced from DNA is called the "Central Dogma", coined by Francis Crick in 1958 (one discoverer of the structure of DNA).  I will stick to the basics of this process.  The entire point of DNA is to be a set of instructions for assembling proteins.  Let us define exactly what a protein is (from Wikipedia):
"Proteins (also known as polypeptides) are organic compounds made of amino acids arranged in a linear chain and folded into a globular form."

Proteins allow cells to burn energy, hold their shape and perform their specified function.  In fact about half of a cell's weight is made up of proteins.  Amino acids are the building blocks that make up proteins, and the order in which these amino acids are placed, accounts for the shape (and therefore function) that proteins take.  A protein's shape is crucial to their function.  In fact, a protein that has the same amino acid (and chemical) composition as another, but is folded (the term for protein shaping) even slightly differently, can have a completely different function.

So we have the general flow of how DNA works:

DNA's specific order is converted to a series of amino acids that are linked and then folded into a protein.

This specific series of DNA that encodes for a specific protein is called a gene.

At each of these levels the complexity of the end result grows.  There are only four different pieces of DNA that encode for data:

A (adenine), C (cytosine), G (guanine) and T (thymine). These are called nucleotides (or base-pairs).  These four different nucleotides code for only twenty-two different amino acids (in multi-celled organism, there are as many as forty used by single celled organisms).  From twenty-two amino acids, there are limitless protein combinations and shapes.

A typical string of DNA twenty-one base-pairs long would be:
ATGACGGAGCTTCGGAGCTAG

This string of DNA is "transcribed" to a string of RNA (ribonucleic acid).  RNA is nearly identical to DNA except thymine (T) is exchanged for uracil (U).  This string is then passed to a cell's organelle called a Ribosome, which reads this strand three base-pairs at a time.  These sequences of three nucleotides are called codons.  In my example of the twenty-one nucleotides, there are seven codons.  The ribosome starts protein synthesis (or translation) at only one specific codon, which is AUG (or ATG for the DNA version).  This also codes for the amino acid Methionine. The second codon ACG codes for Threonine, the third GAG for Glutamic Acid, the fourth CTT (or CUU in RNA) for Leucine, the fifth CGG for Arginine, the sixth AGC for Serine and the last codon TAG (or UAG in RNA) is a stop codon, which tells the ribosome to stop translation of the protein.  You can see a full table for which codons correspond to which amino acids here.  So for our example, we have a protein that is six amino acids long.  After the amino acids are linked together, other proteins come in and fold the amino acid chain into the proper shape.

If you are interested in reading more here is the Central Dogma page on Wikipedia.  Follow the table on the right for a more in-depth explanation of the entire process.

How to Build a Computer Part 1: Pricing and Purchasing

This post will be a two parter. Expect the second part, dealing with actually assembling the computer, in the coming weeks.  There are a few important parts of the computer and they are all pretty standardized now, so finding the correct parts that will work together is actually pretty painless. To build a computer from scratch, you need:

Computer Case

Power Supply (PSU)

Motherboard Processor (CPU)

Memory (RAM)

Optical Disc Drive Hard Drive

Graphics Card (GPU)
A great resource for purchasing parts is the computer build lists at The Tech Report. Here is a link to their just updated guide for Fall '10. They have the builds laid out by component in Processor, Motherboard, Memory, Graphics, Storage, Audio, Enclosure and Power supply with links to Newegg (a computer supplier).  If you look at their "cheapest" system, you can see it is usually a lot cheaper to build your own system than to buy one already built.  Their system at $539.88 has a quad-core AMD processor, two gigabytes of RAM, a one terabyte (1024 gigabyte) hard drive and decent graphics card.  This would be a very capable work or gaming machine.  Another benefit of building your own system is that you can easily upgrade it as you go.  Adding more RAM or swapping the CPU for a faster one in a year or so is very easy and cost effective way to get more out of an aging system.

If you want to build your own system without the help of TechReport, I would suggest going to Newegg and looking at each individual component from their menu under Computer Hardware.  A couple of things to note; when you pick out a case make sure to get one that is large enough to fit everything that you want to put into the system, especially the motherboard.  Go to the details tab and check Motherboard Compatibility, to make sure that it matches up with the motherboard you choose.  ATX is the standard size.  Also, some cases come with power supplies included.  Make sure it will supply enough wattage for your system.  Antec (a manufacturer of high quality cases and power supplies) has a calculator, however if you only have one hard drive, optical drive and graphics card you should be fine with a PSU in the 300-400W range.  You want to have some excess capability because most power supplies don't work as efficiently when they are at the top of their output.  Lastly, for motherboards and processors, make sure to get a processor that fits the same socket as your motherboard.  Current AMD sockets are all the AM3 socket and Intel processors are either LGA 775 or LGA1156 (also with the high performance LGA1366).  When you select a processor and motherboard, it should be displayed prominently which you are looking at.  Also, if you have any questions feel free to ask someone knowledgeable about your build before you purchase.  The Tech Report forums are a great resource, for instance.

Global Warming

I am not going to get into the evidence for (or against) the existence of global warming (or recently labelled climate change in an attempt to make the term more politically correct, I guess?).  The atmosphere of the Earth is getting warmer over time.  Humans are dumping billions of tons of carbon dioxide (a greenhouse gas) into the atmosphere every year (31.8 billion tons).  It shouldn't take a mountain of evidence, which there is, to connect the dots.
I can understand why people, at a visceral level, have a hard time with global warming.  People just see their local weather which makes it easy to dismiss (or even welcome, depending on how cold the weather) a global warming trend.  People also have a hard time understanding how driving their car to work every morning can make the temperature warmer on the other side of the planet.

I don't sympathize, however, with people that outright deny the fact that humans are making Earth warmer, to say nothing of the those that deny it is warming at all (regardless of the cause).  In my mind, this is even worse than the 16th century Church denying the Copernican model of the solar system (in favor of the Ptolemaic model).  The modern socio-scientific literacy of the population in exponentially higher.  This is why I have to think that those who deny the existence of anthropogenic (man-made) global warming, have some motivation for remaining ignorant.  It particularly relevant (infuriatingly so) for policy makers.  Many of them are very intelligent people, who should know better.
One possible motivation is short-term monetary gain.  Burning fossil fuels to power our lives is incredibly cheap, without taking into account long term consequences.  The up-front costs are a fraction of what power from "green technologies" costs, in a purely monetary sense.  For example, as Earth's atmosphere warms and glacial/polar ice melts, the sea levels will rise.  It will be incredibly expensive when lower Manhattan is below sea level (only a few meter rise), to say nothing of nearly all other major cities in the world (which lie close to sea level).

Here are a couple links, for those that want to educate themselves or others:
How to Talk to a Climate Skeptic: Responses to the most common skeptical arguments on global warming

Skeptical Science: Getting skeptical about global warming skepticism

The Movie Game

The "Movie Game" is similar in concept to "Six Degrees of Kevin Bacon".  One person starts the game by naming a movie.  The next person names an actor that was in the movie, and the following person in succession  names a different movie that the actor was in.  This continues on until someone cannot name a corresponding actor or movie, and they are "out".  However, if someone would be knocked out of the game because they could not name an actor, the player that named the movie must name another actor from that movie or they are "out" instead.  This rule was developed because broadly known actors tend to appear in esoteric films or in cameo roles.

This game can also be easily be implemented as a "drinking game" by imposing "drink" penalties on those that get knocked out, or other house rules such as whenever one names a M. Night Shyamalan movie, or actor in one of his movies, one has to take a "drink".  Hint: don't name Die Hard.

Definition of Life

The topic for today is part philosophical and part scientific. The philosophy of describing something as alive or not alive is a lot more grey than the scientific definition. Per Wikipedia, the scientific definition is:

"Living organisms undergo metabolism, maintain homeostasis, possess a capacity to grow, respond to stimuli, reproduce and, through natural selection, adapt to their environment in successive generations."

Lets break the definition down into its part to make it a little easy to understand.  "Living organisms undergo metabolism" means that the organism takes in energy in some form, converts it to a form which can be used and produces some sort of by-product, usually a waste.  The second part, "maintain homeostasis", just means that the organism has some sort of internal ecosystem separate from the exterior ecosystem in which the organism lives.  For a bacteria that is its cell membrane.  For humans it is our skin and external membranes (lining of the mouth and sinuses for example).  The third part, "possess a capacity to grow", ties in with the organism's metabolism, in that as it produces and consumes energy it will naturally become larger or more massive over time.  The fourth part, "respond to stimuli", can be given as a negative example, which is a rock.  Rocks do not respond to their environment except in a physical sense(such as water, wind, heat).  Living organisms, even bacteria, tend to move from environments which are unfriendly (that don't have necessary food, or have harmful toxins) to environments that are more friendly.  The last part, "reproduce and, through natural selection, adapt to their environment in successive generations", is necessary to the continuation of life and describes part of the process of evolution.

I believe this is the most controversial part of the definition.  I recently read a discussion relating to computer viruses and how they fit into the definition of life.  Many of the conclusions on assessing whether or not a string of computer code could be considered life got stuck on that last part of the definition.  My problem with using that as the basis to say computer code can never be alive is that the final part doesn't actually describe life itself, but rather a specific behavior.  An analogy would be for part of the definition of life that life always moves in a counter-clockwise fashion.  Anything that tends to move in a clockwise motion cannot be alive.  That is describing a behavior of the organism in the definition.

This is partly where the philosophy of describing life or "un-life" comes into play.  Many consider biological viruses to actually fit outside the definition of life.  On a technical level, digital viruses may not be the best candidate to look at when trying to point to an artificial form of life, however it will not be too long before artificial intelligence code becomes sufficiently advanced that it easily fills many criteria for even the scientific definition of life.  

Challenge

Today is the first day of a challenge to myself.  The challenge is to write 100 straight days on this blog.  There must be at least one post a day of at least 100 words.  The last day of the challenge is Thursday, December 16, 2010.  The topics I will cover in this blog will be a wide-ranging catch all for whatever I want to talk about in a given day, including politics, sports, technology, physics and anything that is interesting to me.  If this challenge goes well, I will likely continue updating the blog on a bi-weekly or tri-weekly basis.
I am starting this challenge because I write quite a bit, however the style was mostly restricted to technical writing.  While I was in school, it was a scientific style, and work after graduation was a technical assistance and business style.  I am recently unemployed (by choice) and want to improve my writing in a more vocal style.  Hopefully some practice through this challenge will help develop my written voice, as well as be a fun outlet for my thoughts on many subjects (and hopefully some discussion from readers).