Body Mass Index

Body Mass Index (or BMI) is a quick way of converting one's height and weight into one metric.  The problem is that the BMI metric is largely without value.  It is not any better of a metric of health than someone's height or weight alone.  According to the Mayo Clinic:

FINDINGS: We found 40 studies with 250,152 patients that had a mean follow-up of 3.8 years. Patients with a low body-mass index (BMI) (ie, <20) had an increased relative risk (RR) for total mortality (RR=1.37 [95% CI 1.32-1.43), and cardiovascular mortality (1.45 [1.16-1.81]), overweight (BMI 25-29.9) had the lowest risk for total mortality (0.87 [0.81-0.94]) and cardiovascular mortality (0.88 [0.75-1.02]) compared with those for people with a normal BMI. Obese patients (BMI 30-35) had no increased risk for total mortality (0.93 [0.85-1.03]) or cardiovascular mortality (0.97 [0.82-1.15]). Patients with severe obesity (> or =35) did not have increased total mortality (1.10 [0.87-1.41]) but they had the highest risk for cardiovascular mortality (1.88 [1.05-3.34]).

Their data shows that BMI is not a reliable metric for predicting health outcomes.  From a medical or scientific standpoint the metric BMI is just not valuable.  Another study published in the American Journal of Public Health found:

Traditional BMI categories do not conform well to the complexities of the BMI–mortality relationship. In concurrence with conclusions from previous literature, I found that the current definitions of obesity and overweight are imprecise predictors of mortality risk.

If a gut level reaction to assessing health by height and weight alone is not enough, take a look at the Wikipedia section on it.

Some argue that the error in the BMI is significant and so pervasive that it is not generally useful in evaluation of health.  University of Chicagopolitical science professor Eric Oliver says BMI is a convenient but inaccurate measure of weight, forced onto the populace, and should be revised.

The medical establishment has generally acknowledged some shortcomings of BMI. Because the BMI is dependent only upon weight and height, it makes simplistic assumptions about distribution of muscle and bone mass, and thus may overestimate adiposity on those with more lean body mass (e.g. athletes) while underestimating adiposity on those with less lean body mass (e.g. the elderly).

The problem with making the connection between BMI and overall healthfulness is that the metric is then used inappropriately, for example by health insurance companies.

In the United States, where medical underwriting of private health insurance plans is widespread, most private health insurance providers will use a particular high BMI as a cut-off point in order to raise insurance rates for or deny insurance to higher-risk patients, thereby ostensibly reducing the cost of insurance coverage to all other subscribers in a 'normal' BMI range. The cutoff point is determined differently for every health insurance provider and different providers will have vastly different ranges of acceptability.

Another article published in The Dartmouth, Dartmouth College's student newspaper, proposes that insurance and pharmaceutical companies actually have a financial incentive for embracing and perpetuating the use of the flawed BMI metric.

According to Oliver, the "obesity mafia" consists of government health agencies such as the National Institute of Health, the Center for Disease Control and the Food and Drug Administration. These agencies are linked in symbiotic relationships with drug companies and academic researchers, with the trio feeding off one another to perpetuate the myth of widespread obesity in America -- all for financial gain.

Because Moderates Shouldn't Be Drown Out

One of the funny things about political activism, whether on the left or right, is that those with moderate (centrist) viewpoints are often missed.  Talking heads that yell the loudest and espouse the craziest ideas are those that get the most TV time.  For this reason, the only news TV show I watch regularly is The Daily Show.  Last night Jon Stewart and Steven Colbert announced an event at Washington D.C.

We're looking for the people who think shouting is annoying, counterproductive, and terrible for your throat; who feel that the loudest voices shouldn't be the only ones that get heard; and who believe that the only time it's appropriate to draw a Hitler mustache on someone is when that person is actually Hitler. Or Charlie Chaplin in certain roles.

Also Stewart had President Clinton on, who had an excellent interview.
Part 1 and Part 2
Why can't we have democrats that are actually in office do this much?

Best "Always Sunny" Episodes

In celebration of the new season of It's Alway Sunny in Philadelphia, premiering tonight, I have compiled the top episodes.  I am assuming that the reader has watched each of these episodes and just doing a short-hand of the best parts for each of the best episodes.  At the end I will name the top 5 episodes.

Back to Robert Reich

Here is a transcript of one of the most important parts of the video I posted a couple days ago.  I touched briefly on this, however I wanted to post it, because I feel it is very important to consider Reich's words.  Note this speech was made in 2005, before the Tea Party movement.

Starting at 53:18, I transcribed this myself, so corrections are welcome.

The working class, that we used to call it, and the poor, increasingly become vulnerable to demagogues, who come along and take their frustration and their anxiety and turn it into and divert it toward targets of animosity.  We’ve seen this before in history.  I don’t have to tell you.  We’ve seen it a little in the United States, not much, but we have seen angry populism.  We saw it in the 1890’s.  The predecessor of progressivism was populism.  William Jennings Bryant, prairie populism, it was an angry populism.  It was an angry divisive populism.  It was an angry divisive populism that blamed a lot of people, some of them who were scapegoats for that populism.  Anti-modernist movements around the world and historically have been animated by demagogues preying upon the anxieties of people who need targets of resentment.  The politics of resentment is not new, folks and when you hear people accusing people like me of being class warriors what I want you to understand is the failure to act on these trends invites real class warfare.  Indeed you might say what we have begun to see, and we began to see it in the 2004 election, was a kind of angry cultural populism that is the first cousin of angry class populism, cultural populism that blames, blames who? Blames eastern elites and western elites, blames Hollywood, blames university towns like Berkeley, blames Jews, blames the French, blames immigrants, blames others.  The politics of resentments that is carried upon and depends upon anxiety and frustration and is utilized by demagogues to further their own selfish purposes.  That’s what snapping apart, snapping-breaking could invite.

A modern society in the 21st century has universal healthcare, has unemployment benefits, has inexpensive education, women have personal rights in regards to their bodies, people can love whoever they choose, is secular, does not support state-sponsored murder, and is welcoming to immigrants of different races, cultures and religions.  America is heading toward (maybe irreversibly) that "snap" that Reich talks about and the Tea Party is absolutely an agent of change for the worse, which is helping to push us towards it.

Thought Experiment

I conceived of this theoretical physics thought experiment many years ago, and it may not be completely original, however I have not read of any other that is similar. It proves the ability to transfer information faster than light within the model of traditional Newtonian physics.

Imagine a device sitting in space. The central part of this device is a metal rod one light year (9.461×10¹² kilometers) long.  At both ends of this rod are detectors not much more complex than Morse code receivers.  This rod could then be set to move back and forth in such a way that information is passed from one end to the other nearly instantly, which would take a radio wave a year to pass from one end to the other.

Now take this example to the next logical conclusion.  What if the rod was only 0.1 light year long?  How about a few hundred kilometers long?  In theoretical physics, the transfer of information is just as good as actually moving an object.  Imagine that at one end of this device there is a detector that downloads all of the information about an object (in a theoretical sense, this means all of the atoms and particles that make up this object are known).  This data can be then transmitted by the device and reconstructed on the other end.
Now there are many practical problems with this device, however this is just a thought experiment.  If you want to read more about thought experiments here is the Wikipedia page.

Income Inequality in the United States

Timothy Noah at Slate Magazine recently started a series on the growing income disparity between the richest percentage and the poorest percentage.  His first post goes into exactly how great this gap has become and why many Americans are ignorant of the problem. By the numbers "the richest 1 percent account for 24 percent of the nation's income" as well as "from 1980 to 2005, more than 80 percent of total increase in Americans' income went to the top 1 percent".  This is despite a productivity increase (among all workers) of "about 20 percent" in the last decade alone.

Here is a great online lecture by former Secretary of Labor Robert Reich, recorded in April 2005, titled "How Unequal Can America Get Before We Snap?".

At the end of the lecture he unwittingly predicts the Tea Party movement, which is almost prophetic.  This next video is a lecture given by Harvard Law professor, Elizabeth Warren, about the loss of the middle class in America over the past generation.  The first 5:30 is introduction that can be skipped without missing anything important.

From Your DNA to You

In this post I am just going to explain the beginning of the process for how our DNA shapes our bodies.  An incredibly complex series of chemical reactions embody the heart of the mechanism that creates a living organism from what amounts to a series of data, encoded as chemicals known as deoxyribonucleic acid.  The entirety of this process is still somewhat unknown as there are a lot of factors, outside of DNA itself, that contribute to how a complex organism such as humans develop.
In molecular biology, the process by which proteins are produced from DNA is called the "Central Dogma", coined by Francis Crick in 1958 (one discoverer of the structure of DNA).  I will stick to the basics of this process.  The entire point of DNA is to be a set of instructions for assembling proteins.  Let us define exactly what a protein is (from Wikipedia):
"Proteins (also known as polypeptides) are organic compounds made of amino acids arranged in a linear chain and folded into a globular form."

Proteins allow cells to burn energy, hold their shape and perform their specified function.  In fact about half of a cell's weight is made up of proteins.  Amino acids are the building blocks that make up proteins, and the order in which these amino acids are placed, accounts for the shape (and therefore function) that proteins take.  A protein's shape is crucial to their function.  In fact, a protein that has the same amino acid (and chemical) composition as another, but is folded (the term for protein shaping) even slightly differently, can have a completely different function.

So we have the general flow of how DNA works:

DNA's specific order is converted to a series of amino acids that are linked and then folded into a protein.

This specific series of DNA that encodes for a specific protein is called a gene.

At each of these levels the complexity of the end result grows.  There are only four different pieces of DNA that encode for data:

A (adenine), C (cytosine), G (guanine) and T (thymine). These are called nucleotides (or base-pairs).  These four different nucleotides code for only twenty-two different amino acids (in multi-celled organism, there are as many as forty used by single celled organisms).  From twenty-two amino acids, there are limitless protein combinations and shapes.

A typical string of DNA twenty-one base-pairs long would be:
ATGACGGAGCTTCGGAGCTAG

This string of DNA is "transcribed" to a string of RNA (ribonucleic acid).  RNA is nearly identical to DNA except thymine (T) is exchanged for uracil (U).  This string is then passed to a cell's organelle called a Ribosome, which reads this strand three base-pairs at a time.  These sequences of three nucleotides are called codons.  In my example of the twenty-one nucleotides, there are seven codons.  The ribosome starts protein synthesis (or translation) at only one specific codon, which is AUG (or ATG for the DNA version).  This also codes for the amino acid Methionine. The second codon ACG codes for Threonine, the third GAG for Glutamic Acid, the fourth CTT (or CUU in RNA) for Leucine, the fifth CGG for Arginine, the sixth AGC for Serine and the last codon TAG (or UAG in RNA) is a stop codon, which tells the ribosome to stop translation of the protein.  You can see a full table for which codons correspond to which amino acids here.  So for our example, we have a protein that is six amino acids long.  After the amino acids are linked together, other proteins come in and fold the amino acid chain into the proper shape.

If you are interested in reading more here is the Central Dogma page on Wikipedia.  Follow the table on the right for a more in-depth explanation of the entire process.